View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3266_low_25 (Length: 238)

Name: NF3266_low_25
Description: NF3266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3266_low_25
NF3266_low_25
[»] chr3 (1 HSPs)
chr3 (18-238)||(43830537-43830757)


Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 43830537 - 43830757
Alignment:
18 gtaagaatggagctaactggtctcgagatgtcgctcgtttgcacctgcagcttgcagctgctggccttgctacctcattcaaaggcaattaccccgttta 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
43830537 gtaagaatggagctaactggtctcgagatgtcgctcgtttgcacctgcagcttgcagctgctggccttgctacctcattcaaaggcaattaccccattta 43830636  T
118 tgtgctcttcattaccaactgttttctgatactgaatctgtttacctgcaaagaattagttggacgtgaaggaaatgtatggttatacagaccaaacttg 217  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43830637 tgtgctcttcattaccaactgttttccgatactgaatctgtttacctgcaaagaattagttggacgtgaaggaaatgtatggttatacagaccaaacttg 43830736  T
218 agtgttttgagagaaaaggtt 238  Q
    |||||||||||||||||||||    
43830737 agtgttttgagagaaaaggtt 43830757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University