View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3266_low_26 (Length: 218)
Name: NF3266_low_26
Description: NF3266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3266_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 43327283 - 43327478
Alignment:
| Q |
1 |
ctggtgttgtactgtcctcttccatcccatctgccaaagcaacccacttgatgatgatcttattnnnnnnnnnnnnnnnnntattattaatcttcttatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||||| |
|
|
| T |
43327283 |
ctggtgttgtactgtcctcttccatcccatctgccaaagcaacccacttgatgat---cctatcatcatcatcatcatcattattattaatcttcttatg |
43327379 |
T |
|
| Q |
101 |
aacatgttgagggagaactatcacggcttcaaatccttggcttacaaagacagaagctagattttgcatgggactaacatgtccttgtgcgggataggg |
199 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43327380 |
aacatgttgagggaggactatcacggcttcaaatccttggcttacaaagacagaagctagattttgcatgggactaacatgtccttgtgcgggataggg |
43327478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University