View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3266_low_8 (Length: 375)
Name: NF3266_low_8
Description: NF3266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3266_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 2e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 9 - 183
Target Start/End: Complemental strand, 13861364 - 13861193
Alignment:
| Q |
9 |
agcagagattatagaaaatgtgtgggttcttcaatacacacctcctctgagttaaaaatagcatgtttagcgagcatatgagcaatataatttctattac |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13861364 |
agcagagattatagaaaatgtgtgggttcttcaatacacacctc---tgggttaaaaatagcatgtttagcgagcatatgagcaatataatttctattac |
13861268 |
T |
 |
| Q |
109 |
gact-agtgtgagtaaacaaaataagagaaatactgannnnnnnnagaggaagagaaatatttatataatcacaac |
183 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13861267 |
gactaagtgtgagtaaacaaaatacgagaaatactga-tttttttagaggaagagaaatatttatataatcacaac |
13861193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 314 - 359
Target Start/End: Complemental strand, 13861061 - 13861016
Alignment:
| Q |
314 |
cttgtgatcaaacaagtatatctcacaagagaaatctaaagctaaa |
359 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13861061 |
cttgtgatgaaacaagtatatctcacaagagaaatctaaagctaaa |
13861016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University