View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3267_high_10 (Length: 415)
Name: NF3267_high_10
Description: NF3267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3267_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 2e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 263 - 398
Target Start/End: Complemental strand, 35302740 - 35302605
Alignment:
| Q |
263 |
taccctaaaaccctcaaaaaccctacctccattcacctctcttcttacctcgatttcacaaactttttctacaacaattgccccggcgtcgttacctttt |
362 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35302740 |
taccctaaaaccctccaaaaccctacctccattcacctctcttcttacctcgatttcacaaactttttctacaacaattgccccggcgtcgttacctttt |
35302641 |
T |
|
| Q |
363 |
ccgacgctaactccgtcgctcaaaccgccacatttc |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
35302640 |
ccgacgctaactccgtcgctcaaaccgccacatttc |
35302605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University