View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3267_high_11 (Length: 415)
Name: NF3267_high_11
Description: NF3267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3267_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 290; Significance: 1e-162; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 290; E-Value: 1e-162
Query Start/End: Original strand, 20 - 405
Target Start/End: Complemental strand, 44581653 - 44581265
Alignment:
| Q |
20 |
ttctacggtttcacannnnnnngagagggaatatgtctaataaatgggataattcttattgcgtgttccaactctatcactatttcaaggagatgaacat |
119 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
44581653 |
ttctacggtttcacatttttttgagagggaatatgtctaataaatgggataattattattgcgtgttccaacttaatcactctttcaaggagatgaacat |
44581554 |
T |
 |
| Q |
120 |
gtgcaccaactaattagccaagtttgccataaggtctattagtgatttgtcgactgtgtttgatccctcgattgagcttcacttgttgcttaagatagac |
219 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44581553 |
gtgcgccaactaattagccaagtttgaaataaggtctattagttatttatcgactgtgtttgatccctcgattgagcttcacttgttgcttaagatagac |
44581454 |
T |
 |
| Q |
220 |
agtggcggaatatggtggatgcggtcaatagcggtggcggagccgccactcccactcatgggcataggtg---gtgggtacacttgaagatgtgtttgcg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44581453 |
agtggcggaatatggtggatgcggtcaatagcagtggcggagccgccactcccactcatgggcataggtggtggtgggtacacttgaagatgtgtttgca |
44581354 |
T |
 |
| Q |
317 |
atttcaatatatttagagattatgatgaaaatatttcatgtattgagggaagaaaataagaggtaatcttgtttggactcatgcctttg |
405 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||| ||||||||||||||||||||| |||| |
|
|
| T |
44581353 |
atttcaatatatttagagactatgatgaaaatatttcatgtattgagggaacaaaataggagataatcttgtttggactcatgcatttg |
44581265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University