View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3267_high_29 (Length: 250)
Name: NF3267_high_29
Description: NF3267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3267_high_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 43765608 - 43765369
Alignment:
| Q |
1 |
aagttcggtttacaatttgtctaactagtataannnnnnnn-ccaatagtgtaattaaaaagtgatgttgtatagtttgagttaattctaatcataacct |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43765608 |
aagttcggtttacaatttgtctaactagtataatttttttttccaatagtgtaattaaaaagtgatgttgtatagtttgagttaattctaatcataacct |
43765509 |
T |
 |
| Q |
100 |
cagctttgagtttggcattttcaatacgtagttgttgttcttcagttgccatggtaccatctctatttgtggtggggaccccacaattggggcaacaagc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43765508 |
cagctttgagtttggcattttcaatacgtagttgttgttcttcagttgccatggtaccatctctatttgtggtggggaccccacaattggggcaacaagc |
43765409 |
T |
 |
| Q |
200 |
cttatttatggtctctcgtagggtcttatttttctccctt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43765408 |
cttatttatggtctctcgtagggtcttatttttctccctt |
43765369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University