View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3267_high_32 (Length: 247)
Name: NF3267_high_32
Description: NF3267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3267_high_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 234
Target Start/End: Original strand, 3234097 - 3234314
Alignment:
| Q |
17 |
aagaagcaactctttgtatgtctttttactcagatcaagtgaaataatcacatattgctcaaaaggaatattcttgcaatcataacggtggtagttgcga |
116 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3234097 |
aagaagcaactctttgtatgtctgtttactcagataaagtgaaataatcacatattgctcaaaaggaatattcttgcaatcataacggtggtagttgcga |
3234196 |
T |
 |
| Q |
117 |
cgagttgccaaccaattaacattaccactcaaatgcacactccaatttaggcgatgatagagaggaaatctttgaatagttttccaaacattatcgcgga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3234197 |
agagttgccaaccaattaacattaccactcaaatgcacactccaatttaggcgatgatagagaggaaatctttgaatagttttccaaacattatcgcgga |
3234296 |
T |
 |
| Q |
217 |
aactaaaaactcttgcct |
234 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3234297 |
aactaaaaactcttgcct |
3234314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 50 - 101
Target Start/End: Complemental strand, 18326096 - 18326045
Alignment:
| Q |
50 |
atcaagtgaaataatcacatattgctcaaaaggaatattcttgcaatcataa |
101 |
Q |
| |
|
|||||||||||||||| || ||||||||| | ||||||||||||||||||| |
|
|
| T |
18326096 |
atcaagtgaaataatcgcaaattgctcaacaataatattcttgcaatcataa |
18326045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 100
Target Start/End: Original strand, 16839576 - 16839626
Alignment:
| Q |
50 |
atcaagtgaaataatcacatattgctcaaaaggaatattcttgcaatcata |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||| || || || |||||||||||| |
|
|
| T |
16839576 |
atcaagtgaaataatcacaaattgctcaacagtaagatccttgcaatcata |
16839626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 22036993 - 22036933
Alignment:
| Q |
18 |
agaagcaactctttgtatgtctttttactcagatcaagtgaaataatcacatattgctcaa |
78 |
Q |
| |
|
||||||||||||||| |||||| | ||| ||||||||||| || ||||| | ||||||||| |
|
|
| T |
22036993 |
agaagcaactctttgcatgtctctgtacgcagatcaagtgcaacaatcataaattgctcaa |
22036933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University