View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3267_high_35 (Length: 242)
Name: NF3267_high_35
Description: NF3267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3267_high_35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 4626005 - 4626227
Alignment:
| Q |
1 |
ggctttcatggagtttgcagaagctagtggatatccaatagctgtaatgccctccggtaaaggacttgtaccagaaaatcatccacatttcattggaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4626005 |
ggctttcatggagtttgcagaagctagtggatatccaatagctgtaatgccctccggtaaaggacttgtaccagaaaatcatccacatttcattggaaca |
4626104 |
T |
|
| Q |
101 |
tattggggtgctgttagtactagctattgtggggagatagtggagtctgctgatgcttatgtttttgttggtcccatcttcaatgactatagttctgttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4626105 |
tattggggtgctgttagtactagctattgtggggagatagtggagtctgctgatgcttatgtttttgttggtcccatcttcaatgactatagttctgttg |
4626204 |
T |
|
| Q |
201 |
gatactcattgttgataaagaag |
223 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
4626205 |
gatactcgttgttgataaagaag |
4626227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 85 - 208
Target Start/End: Original strand, 20435336 - 20435459
Alignment:
| Q |
85 |
acatttcattggaacatattggggtgctgttagtactagctattgtggggagatagtggagtctgctgatgcttatgtttttgttggtcccatcttcaat |
184 |
Q |
| |
|
||||||||||||||||| ||||||||| || || ||| | ||||| ||||| ||||| || |||||||| || | |||| ||| || || |||||| |
|
|
| T |
20435336 |
acatttcattggaacattttggggtgcagtgagcactgcattttgtgccgagattgtggaatcggctgatgcatacctatttgctggacctattttcaat |
20435435 |
T |
|
| Q |
185 |
gactatagttctgttggatactca |
208 |
Q |
| |
|
|| || |||||||||||||||||| |
|
|
| T |
20435436 |
gattacagttctgttggatactca |
20435459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University