View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3267_high_37 (Length: 241)
Name: NF3267_high_37
Description: NF3267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3267_high_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 6 - 200
Target Start/End: Original strand, 52397971 - 52398164
Alignment:
| Q |
6 |
tattttaacaagagataaatcacttaacagaagttatctatacggtccctcnnnnnnnnngttatgcatatgatcaaaatcaaaaatattcatttt-tta |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
52397971 |
tattttaacaagagataaatcacttaacagaagttttctatgcgatccct--aaaaaaaagttatgcatatgatcaaaatcaaaaatattcattttttta |
52398068 |
T |
|
| Q |
105 |
cctacgtgtcttatataaaaagcatcgaagggtgtatgatgnnnnnnnnnnnnntaaacaaacaaccgataacaatatgtgcataatttttgtaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52398069 |
cctacgtgtcttatataaaaagcatcgaagggagtatgatgaaaaaataaaaaataaacaaacaaccgataacaatatgtgcataatttttgtaat |
52398164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University