View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3267_low_11 (Length: 415)

Name: NF3267_low_11
Description: NF3267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3267_low_11
NF3267_low_11
[»] chr1 (1 HSPs)
chr1 (263-398)||(35302605-35302740)


Alignment Details
Target: chr1 (Bit Score: 132; Significance: 2e-68; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 263 - 398
Target Start/End: Complemental strand, 35302740 - 35302605
Alignment:
263 taccctaaaaccctcaaaaaccctacctccattcacctctcttcttacctcgatttcacaaactttttctacaacaattgccccggcgtcgttacctttt 362  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35302740 taccctaaaaccctccaaaaccctacctccattcacctctcttcttacctcgatttcacaaactttttctacaacaattgccccggcgtcgttacctttt 35302641  T
363 ccgacgctaactccgtcgctcaaaccgccacatttc 398  Q
    ||||||||||||||||||||||||||||||||||||    
35302640 ccgacgctaactccgtcgctcaaaccgccacatttc 35302605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University