View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3267_low_17 (Length: 359)
Name: NF3267_low_17
Description: NF3267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3267_low_17 |
 | |
|
| [»] chr1 (7 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 7)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 119 - 359
Target Start/End: Complemental strand, 2288619 - 2288379
Alignment:
| Q |
119 |
tggacgttaccaaaagacaatggttgcattcctgatggtactataatttgcagaacaactaagcacactctctccgtaagatatggagcaaatgatctta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2288619 |
tggacgttaccaaaagacaatggttgcattcctgatggtactataatttgcagaacaactaagcacactctctccgtaagatatggagcaaatgatctta |
2288520 |
T |
|
| Q |
219 |
tttgtggatggattgttacagcctagaggtctattagattgattgctttccagttttctaattaaagaactatgttttatgctttttgattaagcttgat |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2288519 |
tttgtggatggattgttacagcctagaggtctattagattgattgctttccagttttctaattaaagaactatgttttatgctttttgattaagcttgat |
2288420 |
T |
|
| Q |
319 |
tatgcctatatgattgttttggatatacctatgtttattga |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2288419 |
tatgcctatatgattgttttggatatacctatgtttcttga |
2288379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 18 - 73
Target Start/End: Complemental strand, 2288699 - 2288644
Alignment:
| Q |
18 |
attacagaaacagttgaaagatgggtatctcaccgacatacttatgaaatttaact |
73 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2288699 |
attacagaaacagttgaaagattggtatctcaccgacatacttatgaaatttaact |
2288644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 223 - 291
Target Start/End: Complemental strand, 670502 - 670434
Alignment:
| Q |
223 |
tggatggattgttacagcctagaggtctattagattgattgctttccagttttctaattaaagaactat |
291 |
Q |
| |
|
||||||| ||| || ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
670502 |
tggatgggttgctagagcctagaggtctattagattacatgctttccagttttctaattaaagaactat |
670434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 294 - 340
Target Start/End: Complemental strand, 2288378 - 2288332
Alignment:
| Q |
294 |
tttatgctttttgattaagcttgattatgcctatatgattgttttgg |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2288378 |
tttatgctttttgattaagcttgattatgcctatatgattgtattgg |
2288332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 71 - 119
Target Start/End: Complemental strand, 670653 - 670605
Alignment:
| Q |
71 |
actcccgttcatttttattatgaatgaactatttaaagtgggcttgttt |
119 |
Q |
| |
|
||||| |||| ||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
670653 |
actccagttcgtttttataatgaatgaactatttaaagtgggtttgttt |
670605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 121 - 155
Target Start/End: Complemental strand, 14470304 - 14470270
Alignment:
| Q |
121 |
gacgttaccaaaagacaatggttgcattcctgatg |
155 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14470304 |
gacgttaccaaaagacaatggttgcattcttgatg |
14470270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 132 - 176
Target Start/End: Complemental strand, 670579 - 670535
Alignment:
| Q |
132 |
aagacaatggttgcattcctgatggtactataatttgcagaacaa |
176 |
Q |
| |
|
|||||||||||| ||||||| |||| ||||||| ||||||||||| |
|
|
| T |
670579 |
aagacaatggttacattccttatggaactataacttgcagaacaa |
670535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University