View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3267_low_40 (Length: 241)

Name: NF3267_low_40
Description: NF3267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3267_low_40
NF3267_low_40
[»] chr4 (1 HSPs)
chr4 (6-200)||(52397971-52398164)


Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 6 - 200
Target Start/End: Original strand, 52397971 - 52398164
Alignment:
6 tattttaacaagagataaatcacttaacagaagttatctatacggtccctcnnnnnnnnngttatgcatatgatcaaaatcaaaaatattcatttt-tta 104  Q
    ||||||||||||||||||||||||||||||||||| ||||| || |||||          |||||||||||||||||||||||||||||||||||| |||    
52397971 tattttaacaagagataaatcacttaacagaagttttctatgcgatccct--aaaaaaaagttatgcatatgatcaaaatcaaaaatattcattttttta 52398068  T
105 cctacgtgtcttatataaaaagcatcgaagggtgtatgatgnnnnnnnnnnnnntaaacaaacaaccgataacaatatgtgcataatttttgtaat 200  Q
    |||||||||||||||||||||||||||||||| ||||||||             ||||||||||||||||||||||||||||||||||||||||||    
52398069 cctacgtgtcttatataaaaagcatcgaagggagtatgatgaaaaaataaaaaataaacaaacaaccgataacaatatgtgcataatttttgtaat 52398164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University