View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3267_low_45 (Length: 238)
Name: NF3267_low_45
Description: NF3267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3267_low_45 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 43766030 - 43765810
Alignment:
| Q |
18 |
tgtagccatctttataagctcctccattgcttggtttactacatccattattcttgactcatcaagaccaaaaattccagtataaaaatccaaagagctt |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43766030 |
tgtagccatcttgataagctcctccattgcttggtttactacatccattattcttgactcatcaagacaaaaaattccagtataaaaatccaaagagctt |
43765931 |
T |
|
| Q |
118 |
ttaatattctcttggtcatggctagtggaacatgaaggtgatattgtccctgatgcatatttccctaaagctgctctcagcctctctacctacacatgtg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43765930 |
ttaatattctcttggtcatggctagtggaacatgaaggtgacattgtccctgatgcatatttccctaaagctgctctcagcctctctacctacacatgtg |
43765831 |
T |
|
| Q |
218 |
tcaatttagagtgtcattttt |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43765830 |
tcaatttagagtgtcattttt |
43765810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University