View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3268_low_3 (Length: 365)
Name: NF3268_low_3
Description: NF3268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3268_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 44 - 267
Target Start/End: Complemental strand, 46709140 - 46708914
Alignment:
| Q |
44 |
gtgtctgtaattacaattgatat---gatataaaagattgggagaacatttggtatgttagggtgtggtttggaattcacaagtcccacttcttagcatt |
140 |
Q |
| |
|
||||| |||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
46709140 |
gtgtccgtaattacgattgatattatgatataaaagattgggagaacatttggtatgttagggtgtggtttggaatgcacaagtcccacttcttagcact |
46709041 |
T |
|
| Q |
141 |
attttaatgtgtgtgaattttgtcgttagatttaattgactatccaaccgatgattttggtcaaatagacaatgaaccgttttaaacttttctaatgcat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46709040 |
attttaatgtgtgtgaattttgtcgttagacttaattgactatccaaccgatgattttggtcaaatagacaatgaaccgttttaaacttttctaatgcat |
46708941 |
T |
|
| Q |
241 |
tgacacatacatattctttcatttcgt |
267 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
46708940 |
tgacacatacatattctttcatttcgt |
46708914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 259 - 352
Target Start/End: Complemental strand, 46708740 - 46708647
Alignment:
| Q |
259 |
tcatttcgtttgtcaacatcttcgtaaaatttagcatagctcaaacaatgacaacaaaaaacctaaaaattggcatgattgttcgaagaagctg |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46708740 |
tcatttcgtttgtcaacatcttcgtaaaatttagcatagctcaaacaatgacaacaaaaaacctaaaaattggcatgattgtccgaagaagctg |
46708647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University