View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3268_low_4 (Length: 335)
Name: NF3268_low_4
Description: NF3268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3268_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 1 - 325
Target Start/End: Complemental strand, 44242144 - 44241820
Alignment:
| Q |
1 |
atttctggctttagaaatatgcttttatccactttgcttgtttccaaaggagttccattttcatccctctcctggagttcaccctgatcagccatggcca |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44242144 |
atttctggctttagaaatctgcttttatccactttgcttgtttccaaaggagttccattttcatccctctcctggagttcaccctgatcagccatggcca |
44242045 |
T |
|
| Q |
101 |
cttgaacatcccaattcttttggtttaattttcgcgaaacacccaaactccttctcttattactacttaaggaactcacattcttgccattgctagcagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44242044 |
cttgaacatcccaattcttttggtttaattttcgcgaaacacccaaactccttctcttattactacttaaggaactcacattcttgccattgctagcagt |
44241945 |
T |
|
| Q |
201 |
agaactatctggtggactgaatctgttaacaggagctgatctcctccttagattcgccattactgaaccaggattacatgaattttgagacaccggagga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44241944 |
agaactatctggtggactgaatctgttaacaggagctgatctcctccttagattcgccattactgaaccaggattacatgaattttgagacaccggagga |
44241845 |
T |
|
| Q |
301 |
taccgcccatcactcgcattctctg |
325 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44241844 |
taccgcccatcactcgcattctctg |
44241820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University