View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3268_low_9 (Length: 238)
Name: NF3268_low_9
Description: NF3268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3268_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 47582337 - 47582118
Alignment:
| Q |
1 |
attttcctctgcagcaactggttggaacttcagctatggcatcactaagacaccagctgcagttctctgcagataggcacgggaggcaccaagcaccgcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47582337 |
attttcctctgcagcaactggttggaacttcagctatggcatcactaagacaccagctgcagttctctgcagataggcatgggaggcaccaagcaccgcc |
47582238 |
T |
|
| Q |
101 |
atatactttttggttttctgtgaggttcactgacttgacagcaaattttgcagaagcatttccagtctcccttctcaaatcgtttaacatatcccaaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47582237 |
atatactttttggttttctgtgaggttcactgacttgacagcaaattttgcagaagcatttccagtctcccttctcaaatcgtttaacatatcccaaaga |
47582138 |
T |
|
| Q |
201 |
atgttgttgaagcgcccaac |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
47582137 |
atgttgttgaagcgcccaac |
47582118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 47572639 - 47572419
Alignment:
| Q |
1 |
attttcctctgcagcaactggttggaacttcagctatggcatcactaagacaccagctgcagttctctgcagataggcacgggaggcaccaagcaccgcc |
100 |
Q |
| |
|
||||||||||||| ||||| ||||||| ||| ||||||||||| |||||||||||||| ||||| |||| ||||||| | |||| ||||||| || || |
|
|
| T |
47572639 |
attttcctctgcaacaactagttggaatttctgctatggcatcgctaagacaccagctacagttttctgaagataggtatgggacgcaccaaacataacc |
47572540 |
T |
|
| Q |
101 |
atatactttttggttttctgtgaggttcactgacttgacagcaaattttgcagaagcatttccagtctcccttctcaaatcgtttaacatatcccaaaga |
200 |
Q |
| |
|
||||| ||||||||| ||||||| ||||||||||| |||| |||||| ||||||||||| | | ||| ||||||||||||| ||||||||||| ||| |
|
|
| T |
47572539 |
atatagtttttggttgtctgtgatattcactgacttatcagccaattttccagaagcatttgctgcctcgtttctcaaatcgttcaacatatcccagaga |
47572440 |
T |
|
| Q |
201 |
atgttgttgaagcgcccaact |
221 |
Q |
| |
|
|||||||||||||| |||||| |
|
|
| T |
47572439 |
atgttgttgaagcgtccaact |
47572419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University