View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3270_high_28 (Length: 254)
Name: NF3270_high_28
Description: NF3270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3270_high_28 |
 |  |
|
| [»] scaffold0051 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0051 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 13 - 238
Target Start/End: Complemental strand, 10204 - 9980
Alignment:
| Q |
13 |
aaaatcacctagggattaattnnnnnnnncacctaggactttttagtaattttgtgcactagagatagggtttagtggtagattaacctaatataagctt |
112 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10204 |
aaaatcacctagggattaattaaaaaaaacacctaggactttttagtaattttgtgcactagagatagggtttagtggtagattaacctaatataagctt |
10105 |
T |
 |
| Q |
113 |
tttcaatata-gaagaattgaaaaacctaatttgagtttttacactaatgaaattcttgcggcctctcaccctcttccgtcctacatctctcaatttgtc |
211 |
Q |
| |
|
||| |||||| | ||||||||||||||||||||||||||||||| | || ||| ||||||||||||||| ||||||| |||| ||||||||||||||||| |
|
|
| T |
10104 |
tttaaatatagggagaattgaaaaacctaatttgagtttttaca-ttatcaaactcttgcggcctctca-cctcttctgtcccacatctctcaatttgtc |
10007 |
T |
 |
| Q |
212 |
agaacgtaacgagttgcacctaatttg |
238 |
Q |
| |
|
||||||||||||||| ||||||||||| |
|
|
| T |
10006 |
agaacgtaacgagttacacctaatttg |
9980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University