View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3270_high_32 (Length: 246)
Name: NF3270_high_32
Description: NF3270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3270_high_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 22 - 229
Target Start/End: Original strand, 48019780 - 48019987
Alignment:
| Q |
22 |
aactggcgccgcttctctcctccgtcaattcgatcgcgccgaagattcttcttccaaagcgaatcgcattggtctctcctcctaaactcttctcaacacg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48019780 |
aactggcgccgcttctctcctccgtcaattcgatcgcgccgaagattcttcttccaaagcgaatcgcattggtctctcctcctaaactcttctcaacacg |
48019879 |
T |
 |
| Q |
122 |
ctccttctctctttccccttccgatatggaggttgaagtcaagcttcgtctcccaaacgcagattcttatcgccatgtcactactttgctttctcccttc |
221 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
48019880 |
ctccttttctctttccccttccgatatggaggttgaagtcaagcttcgtctcccaaacgcagattcttatcaccgtgtcactactttgctttctcccttc |
48019979 |
T |
 |
| Q |
222 |
cacgttat |
229 |
Q |
| |
|
|||||||| |
|
|
| T |
48019980 |
cacgttat |
48019987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 142 - 226
Target Start/End: Original strand, 48024686 - 48024770
Alignment:
| Q |
142 |
ccgatatggaggttgaagtcaagcttcgtctcccaaacgcagattcttatcgccatgtcactactttgctttctcccttccacgt |
226 |
Q |
| |
|
|||| ||||| || ||||| ||||| |||||| ||||||| || || ||||||| ||||| ||||||| |||||||||||||| |
|
|
| T |
48024686 |
ccgaaatggaagtggaagtaaagctacgtctcgcaaacgccgaagctcatcgccaagtcaccgctttgctctctcccttccacgt |
48024770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University