View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3270_high_38 (Length: 236)
Name: NF3270_high_38
Description: NF3270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3270_high_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 30874855 - 30875058
Alignment:
| Q |
18 |
caggtaggttagatggttgtttaggaaacctaggttacctttcgataaagagaaaacataaaataattcaacccttaactaataagtaattcttgcacat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30874855 |
caggtaggttagatggttgtttaggaaacctaggttacctttcgataaagagaaaacataaaataattcaacccttaactaataagtaattcttgcacat |
30874954 |
T |
 |
| Q |
118 |
gttgaacaagtagtttatacaaaaacattagtggttttgctttctttctttcatcgattaataaacaaaaacacgcaatttgtacgaggctttgttgacc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30874955 |
gttgaacaagtagtttatacaaaaacattagtggttttgctttctttctttcatcgattaataaacaaaaacacgcaatttgtacgaggctttgttgacc |
30875054 |
T |
 |
| Q |
218 |
acaa |
221 |
Q |
| |
|
|||| |
|
|
| T |
30875055 |
acaa |
30875058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University