View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3270_low_14 (Length: 393)
Name: NF3270_low_14
Description: NF3270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3270_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 3e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 196 - 334
Target Start/End: Original strand, 8447911 - 8448049
Alignment:
| Q |
196 |
tgttaggcaatgacgtcactacatggggggacaaccatgaagccatgcgcaatttgatttgcggtccttccttccttccttactcttttcttttatttat |
295 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8447911 |
tgttaggtaatgacgtcactacatggggggacaaccatgaagccatgcgcaatttgatttgcggtccttccttccttccttactcttttcttttatttat |
8448010 |
T |
|
| Q |
296 |
tctttataattaatcccctcacacactcctaacagaaaa |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8448011 |
tctttataattaatcccctcacacactcctaacagaaaa |
8448049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 18 - 150
Target Start/End: Original strand, 8447733 - 8447865
Alignment:
| Q |
18 |
aaaatattgatgtatgattagcattgagttcaatttcccgcggatgcagtgcagtcataggtatgaatgaagtagatggaaatgtgtgccattttgttta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8447733 |
aaaatattgatgtatgattagcattgagttcaatttcccgcggatgcagtgcagtcataggtatgaatgaagtagatggaaatttgtgccattttgttta |
8447832 |
T |
|
| Q |
118 |
ttgaatccttgatgagagttagacatattctgc |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
8447833 |
ttgaatccttgatgagagttagacatattctgc |
8447865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University