View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3270_low_24 (Length: 264)
Name: NF3270_low_24
Description: NF3270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3270_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 29 - 219
Target Start/End: Complemental strand, 35201168 - 35200977
Alignment:
| Q |
29 |
atagcattttctttt-ctttcaagttgttagtatcaagatcttaataacatgaacaaaaaatataagacaattgcatggaccttttacagataaacatac |
127 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35201168 |
atagcattttctttttctttcaagttgttagtatcaagatcttaataacatgaacaaaaaatataagacaattgcatggaccttttacagataaacatac |
35201069 |
T |
 |
| Q |
128 |
gtatatattaggtaataaagatggtttctctattaagatagtatttattcataaagggagagacaaattaacagaagtatataatgataaac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35201068 |
gtatatattaggtaataaagatggtttctctattaagatagtatttattcataaagggagagacaaattaacagaagtatataatgataaac |
35200977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University