View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3270_low_29 (Length: 255)
Name: NF3270_low_29
Description: NF3270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3270_low_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 1516151 - 1516398
Alignment:
| Q |
1 |
tgtgttaatctttctttggatttatatacctagaacatgagttagtacgattatatatataacgtgcggaaattaataaatgttttgatgaattgcagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1516151 |
tgtgttaatctttctttggatttatatacctagaacatgagttagtacgattatatatataacgtgcggaaattaataaatgttttgatgaattgcagat |
1516250 |
T |
|
| Q |
101 |
atccactttggtttttatacttgttgctgacctaggaggatttggcttgaccatgataatcaccttctttgtggtgaagtcctcctttcgtgttcatgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1516251 |
atccactttggtttttatacttgttgctgacctaggaggatttggcttgaccatgataatcaccttctttgtggtgaagtcctcctttcgtgttcatgct |
1516350 |
T |
|
| Q |
201 |
gttgggttgatttgtgccatttttaacattgcagtctgtgctcctcct |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
1516351 |
gttgggttgatttgtgccatttttaacattgcagtctttgctgctcct |
1516398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 68 - 164
Target Start/End: Complemental strand, 40444646 - 40444550
Alignment:
| Q |
68 |
ggaaattaataaatgttttgatgaattgcagatatccactttggtttttatacttgttgctgacctaggaggatttggcttgaccatgataatcacc |
164 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |||||| ||| |||| | ||||| ||||||||||| |||||||||||| |
|
|
| T |
40444646 |
ggaaattaattaatgttttgatgaattgcagatatccactttggttttgatacttattgttgacatgggaggttttggcttgacaatgataatcacc |
40444550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University