View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3270_low_33 (Length: 250)
Name: NF3270_low_33
Description: NF3270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3270_low_33 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 28 - 250
Target Start/End: Original strand, 48019351 - 48019569
Alignment:
| Q |
28 |
ccgaaaatgtttgattgtgttttccgggtgagatttgaatactgaaaaactcaaaagtaatttttcaatgtgtttaagcaaacttacttctctctctgct |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48019351 |
ccgaaaatgtttgattgtgttttccgggtgagatttgaatactgaaaaactcaaaagtaatttttcaatgtgtttaagcaaacttacttctc----tgct |
48019446 |
T |
 |
| Q |
128 |
gcaaaccagaaactttcaaaagaatttgagagcaacaaaacttgcgtttacatacatactatggcaaaatgtatgggcccaacaaaacttggtttgatag |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48019447 |
gcaaaccagaaactttcaaaagaatttgagagcaacaaaacttgcgtttacatacatactatggcaaaatgtatgggcccaacaaaacttggtttgatag |
48019546 |
T |
 |
| Q |
228 |
cttttctgtaactatctacaccc |
250 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
48019547 |
cttttctgtaactatctacaccc |
48019569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University