View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3270_low_39 (Length: 239)
Name: NF3270_low_39
Description: NF3270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3270_low_39 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 49041301 - 49041081
Alignment:
| Q |
1 |
ttgatgagttgcagaagaatcttcaactcagtgagtggcatatggaaccgtctcggatgactctgcatagatttggaaacacttcaagcagttctctatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49041301 |
ttgatgagttgcagaagaatcttcaactcagtgagtggcatatggaaccgtctcggatgactctgcatagatttggaaacacttcaagcagttctctatg |
49041202 |
T |
|
| Q |
101 |
gtatgaactggcttatactgaggcaaagggcagggttgcaaaaggggatcgggtctggcagattgcatttgggtcgggttttaagtgtaacagcgccgtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49041201 |
gtatgaactggcttatactgaggcaaagggccgggttgcaaaaggggatcgggtctggcagattgcatttgggtcgggttttaagtgtaacagcgccgtg |
49041102 |
T |
|
| Q |
201 |
tggaaggccgtgcgcgacttg |
221 |
Q |
| |
|
|||||||||||||| |||||| |
|
|
| T |
49041101 |
tggaaggccgtgcgtgacttg |
49041081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 120 - 204
Target Start/End: Original strand, 49040232 - 49040316
Alignment:
| Q |
120 |
gaggcaaagggcagggttgcaaaaggggatcgggtctggcagattgcatttgggtcgggttttaagtgtaacagcgccgtgtgga |
204 |
Q |
| |
|
||||| ||||| || ||| |||| |||||| |||| |||||||||||||||||| | |||||||| |||||||| ||||| |||| |
|
|
| T |
49040232 |
gaggccaagggtagagtttcaaagggggatagggtgtggcagattgcatttggggcaggttttaaatgtaacagtgccgtatgga |
49040316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 3 - 190
Target Start/End: Original strand, 15239505 - 15239692
Alignment:
| Q |
3 |
gatgagttgcagaagaatcttcaactcagtgagtggcatatggaaccgtctcggatgactctgcatagatttggaaacacttcaagcagttctctatggt |
102 |
Q |
| |
|
||||||||| |||| |||||| | | ||||| |||||||||||||| || ||||||| ||| |||||||||| |||||||| || ||||| | |||| |
|
|
| T |
15239505 |
gatgagttggagaaaaatcttgatttaagtgattggcatatggaaccatcaaggatgacactgaatagatttggtaacacttctagtagttcattgtggt |
15239604 |
T |
|
| Q |
103 |
atgaactggcttatactgaggcaaagggcagggttgcaaaaggggatcgggtctggcagattgcatttgggtcgggttttaagtgtaa |
190 |
Q |
| |
|
||||| ||||||||||||| || || || ||| || |||||| ||| | ||||| ||||||||||| || |||||||||||||| |
|
|
| T |
15239605 |
atgaattggcttatactgaagctaaagggaggattaaaaaaggtgatagaacttggcaaattgcatttggttctggttttaagtgtaa |
15239692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 13 - 203
Target Start/End: Original strand, 34053214 - 34053404
Alignment:
| Q |
13 |
agaagaatcttcaactcagtgagtggcatatggaaccgtctcggatgactctgcatagatttggaaacacttcaagcagttctctatggtatgaactggc |
112 |
Q |
| |
|
|||| |||||| | || ||||| |||||||||||||| || | ||||| || |||||||||| || ||||| || ||||| ||||||||||| |||| |
|
|
| T |
34053214 |
agaaaaatcttgaccttagtgattggcatatggaaccatcaagaatgacactaaatagatttggtaatacttctagtagttcattatggtatgaattggc |
34053313 |
T |
|
| Q |
113 |
ttatactgaggcaaagggcagggttgcaaaaggggatcgggtctggcagattgcatttgggtcgggttttaagtgtaacagcgccgtgtgg |
203 |
Q |
| |
|
||||||||| || || || ||| || |||||| ||| || ||||| ||||||||||| || || ||||| |||||||| || |||||| |
|
|
| T |
34053314 |
ttatactgaagctaaagggaggattagaaaaggtgataggacttggcaaattgcatttggttctggatttaaatgtaacagtgctgtgtgg |
34053404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University