View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3270_low_39 (Length: 239)

Name: NF3270_low_39
Description: NF3270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3270_low_39
NF3270_low_39
[»] chr7 (2 HSPs)
chr7 (1-221)||(49041081-49041301)
chr7 (120-204)||(49040232-49040316)
[»] chr1 (2 HSPs)
chr1 (3-190)||(15239505-15239692)
chr1 (13-203)||(34053214-34053404)


Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 49041301 - 49041081
Alignment:
1 ttgatgagttgcagaagaatcttcaactcagtgagtggcatatggaaccgtctcggatgactctgcatagatttggaaacacttcaagcagttctctatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49041301 ttgatgagttgcagaagaatcttcaactcagtgagtggcatatggaaccgtctcggatgactctgcatagatttggaaacacttcaagcagttctctatg 49041202  T
101 gtatgaactggcttatactgaggcaaagggcagggttgcaaaaggggatcgggtctggcagattgcatttgggtcgggttttaagtgtaacagcgccgtg 200  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49041201 gtatgaactggcttatactgaggcaaagggccgggttgcaaaaggggatcgggtctggcagattgcatttgggtcgggttttaagtgtaacagcgccgtg 49041102  T
201 tggaaggccgtgcgcgacttg 221  Q
    |||||||||||||| ||||||    
49041101 tggaaggccgtgcgtgacttg 49041081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 120 - 204
Target Start/End: Original strand, 49040232 - 49040316
Alignment:
120 gaggcaaagggcagggttgcaaaaggggatcgggtctggcagattgcatttgggtcgggttttaagtgtaacagcgccgtgtgga 204  Q
    ||||| ||||| || ||| |||| |||||| |||| |||||||||||||||||| | |||||||| |||||||| ||||| ||||    
49040232 gaggccaagggtagagtttcaaagggggatagggtgtggcagattgcatttggggcaggttttaaatgtaacagtgccgtatgga 49040316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 3 - 190
Target Start/End: Original strand, 15239505 - 15239692
Alignment:
3 gatgagttgcagaagaatcttcaactcagtgagtggcatatggaaccgtctcggatgactctgcatagatttggaaacacttcaagcagttctctatggt 102  Q
    ||||||||| |||| |||||| |  | ||||| |||||||||||||| ||  ||||||| ||| |||||||||| |||||||| || |||||  | ||||    
15239505 gatgagttggagaaaaatcttgatttaagtgattggcatatggaaccatcaaggatgacactgaatagatttggtaacacttctagtagttcattgtggt 15239604  T
103 atgaactggcttatactgaggcaaagggcagggttgcaaaaggggatcgggtctggcagattgcatttgggtcgggttttaagtgtaa 190  Q
    ||||| ||||||||||||| || || || ||| ||  |||||| ||| |    ||||| ||||||||||| || ||||||||||||||    
15239605 atgaattggcttatactgaagctaaagggaggattaaaaaaggtgatagaacttggcaaattgcatttggttctggttttaagtgtaa 15239692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 13 - 203
Target Start/End: Original strand, 34053214 - 34053404
Alignment:
13 agaagaatcttcaactcagtgagtggcatatggaaccgtctcggatgactctgcatagatttggaaacacttcaagcagttctctatggtatgaactggc 112  Q
    |||| |||||| | || ||||| |||||||||||||| ||  | ||||| ||  |||||||||| || ||||| || |||||  ||||||||||| ||||    
34053214 agaaaaatcttgaccttagtgattggcatatggaaccatcaagaatgacactaaatagatttggtaatacttctagtagttcattatggtatgaattggc 34053313  T
113 ttatactgaggcaaagggcagggttgcaaaaggggatcgggtctggcagattgcatttgggtcgggttttaagtgtaacagcgccgtgtgg 203  Q
    ||||||||| || || || ||| ||  |||||| ||| ||   ||||| ||||||||||| || || ||||| |||||||| || ||||||    
34053314 ttatactgaagctaaagggaggattagaaaaggtgataggacttggcaaattgcatttggttctggatttaaatgtaacagtgctgtgtgg 34053404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University