View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3270_low_46 (Length: 213)
Name: NF3270_low_46
Description: NF3270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3270_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 44073873 - 44073699
Alignment:
| Q |
18 |
tgcacaatatccatagttagattggnnnnnnngtcttaaactttttaacatttttgcgttactaaagaagaagaatctgattatgaagtggtcccaagtc |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44073873 |
tgcacaatatccatagttagattggtttttttgtcttaaactttttaacatttttgcgttactaaagaagaagaatctgattatgaagtggtcccaagtc |
44073774 |
T |
 |
| Q |
118 |
ccaacaagaccttttctaattctcattcaagtcccactcactcactcccacacaaattgacctcgctcaagttatttct |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44073773 |
ccaacaagaccttttctaattctcattcaagtcccactc----actcccacacaaattgacctcactcaagttatttct |
44073699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University