View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3270_low_7 (Length: 529)
Name: NF3270_low_7
Description: NF3270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3270_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-100; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 19 - 228
Target Start/End: Complemental strand, 6714371 - 6714162
Alignment:
| Q |
19 |
gtcttgggttgaaagatgtaaggttttttaacatagttttgttggcaaagtggatgtggaatttactatcaaaaggtgaatcgttgctgaagaaggtgtt |
118 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |||||||||||| |
|
|
| T |
6714371 |
gtcttgggttgaaagatgtaaggctttttaacatagttttgttggcaaagtggatgtggaatttattatcaaaaggtgaatcgttacggaagaaggtgtt |
6714272 |
T |
|
| Q |
119 |
gatagtaaagtatatgaatctattttggtcaatcctgatgtgtctagttacaatgtattgtatcttgcttccttgtggtcgtctctgacttaccctttgg |
218 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6714271 |
gatagcaaagtatatgaatctattttggtcaatcctgatgtgcctagttacaatgtattgtatcttgcttccttgtggtcgtctctgacttaccctttgg |
6714172 |
T |
|
| Q |
219 |
tgttctctga |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
6714171 |
tgttctctga |
6714162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 133; E-Value: 6e-69
Query Start/End: Original strand, 285 - 501
Target Start/End: Complemental strand, 6714153 - 6713925
Alignment:
| Q |
285 |
gtgaaagtggttgtttaatatcttggtataggttcttgctttgcggatcaattatctagggttttctagtttccaatcaaagagatgtggtctctgactt |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6714153 |
gtgaaagtggttgtttaatatcttggtataggttcttgctttgcggatcaattatctagggttttctagtttccaatcaaagagatgtggtctctgactt |
6714054 |
T |
|
| Q |
385 |
acgtaccctttgatgtaaggc------------nnnnnnnnnnatccaagaacaagatttaagggtggannnnnnnaacctcattagtagtgaaacccta |
472 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
6714053 |
acgtaccctttgatgtaaggcttttttttttttttttttttttatccaagaacaagatttaagggtggatttttttaacctcattagtagttaaacccta |
6713954 |
T |
|
| Q |
473 |
actcttatggaggataatgtgtcttgggt |
501 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6713953 |
actcttatggaggataatgtgtcttgggt |
6713925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University