View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3271_high_13 (Length: 364)
Name: NF3271_high_13
Description: NF3271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3271_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 293; Significance: 1e-164; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 21 - 329
Target Start/End: Original strand, 45122696 - 45123004
Alignment:
| Q |
21 |
tgtggaatatttgttagagatgtgccacgaagaaaaagagtttgttcgtgacttcatggcacagccggtagctggagctgcagttgccgccaccgagagt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45122696 |
tgtggaatatttgttagagatgtgccacgaagaaaaagagtttattcgtgacttcatggcacagccggtagctggagctgccgttgccgccaccgagagt |
45122795 |
T |
 |
| Q |
121 |
agcagtgagatgattgtagtctctgatgagtcacctgagcttcttcctccgtccacatcctctagagcttgcattatctctttgaataactccgcggcaa |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45122796 |
agcagtgagatgattgtagtctctgatgagtcacctgagcttcttcctccgtccacatcctctagagcttgcattatctctttagataactccgcggcaa |
45122895 |
T |
 |
| Q |
221 |
taccgttaccagctgtgatgtccaaatccaaaccaccacggtgtcccacaaaaaagaggacttctgagagaggaaaaggagaaaagaagaatattaaaac |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45122896 |
taccgttaccagctgtgatgtccaaatccaaaccaccacggtgtcccacaaaaaagaggacttctgagagaggaaaaggagaaaagaagaatattaaaac |
45122995 |
T |
 |
| Q |
321 |
tctagatca |
329 |
Q |
| |
|
||||||||| |
|
|
| T |
45122996 |
tctagatca |
45123004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 328 - 357
Target Start/End: Original strand, 45123099 - 45123128
Alignment:
| Q |
328 |
caaattatttactcgtttattcctttgctt |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45123099 |
caaattatttactcgtttattcctttgctt |
45123128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University