View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3271_high_21 (Length: 266)
Name: NF3271_high_21
Description: NF3271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3271_high_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 30684325 - 30684113
Alignment:
| Q |
1 |
cctctttttaggtttattcatatccggtggctgctagggtgtatcactgcgatttgtggtgtacggtaccctaggataaattagtaatctcaac-tagtc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30684325 |
cctctttttaggtttattcatatccggtggctgctagggtgtatcactgcgatttgtggtgtacggtaccctaggataaattagtaatctcaacttagtc |
30684226 |
T |
|
| Q |
100 |
acacacgttaaatcctt-ttttagcattgtcatatgtgatgtgacattcccactacaatgtcatgcacgtgagatccgacatcgagtaagtgagttagcg |
198 |
Q |
| |
|
||||| ||||||||||| ||| ||||||| |||||||||| |||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30684225 |
acacaagttaaatccttctttgagcattgacatatgtgatctgacattcccaccacaatgtcatgcacgtgggatccgacatcgagtaagtgagttagcg |
30684126 |
T |
|
| Q |
199 |
aaaagctatgaag |
211 |
Q |
| |
|
||||||||||||| |
|
|
| T |
30684125 |
aaaagctatgaag |
30684113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University