View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3271_high_23 (Length: 257)

Name: NF3271_high_23
Description: NF3271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3271_high_23
NF3271_high_23
[»] chr2 (1 HSPs)
chr2 (1-240)||(1329815-1330054)


Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 1329815 - 1330054
Alignment:
1 ctgcaccagcaacaagtgaaggtggaataaaagcacttccatggcatgcatttgacgagagtgcagattgggaaacagcgttggtacaatcaaccagcca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
1329815 ctgcaccagcaacaagtgaaggtggaataaaagcacttccatggcatgcatttgatgagagtgcagattgggaaacagcgttggtacaatcaaccagcca 1329914  T
101 cttaggaaaccagcagcctgcattaggtggaggctttgatacattattgttggatggtatgtataaacaaggagaaatgaatgcagccatgcaaggagtg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1329915 cttaggaaaccagcagcctgcattaggtggaggctttgatacattattgttggatggtatgtataaacaaggagaaatgaatgcagccatgcaaggagtg 1330014  T
201 ggatatggttgcagtggaagtgctagcagtgtagcacttg 240  Q
    ||||||||| ||||||||||||||||||||||||||||||    
1330015 ggatatggtggcagtggaagtgctagcagtgtagcacttg 1330054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University