View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3271_high_32 (Length: 239)
Name: NF3271_high_32
Description: NF3271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3271_high_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 94; Significance: 5e-46; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 100 - 221
Target Start/End: Complemental strand, 26148154 - 26148033
Alignment:
| Q |
100 |
cagaccagaagatttgttggcaaattcctatcatagcctccgtaacagccaccataacggcccctaggacttttctttcgcttttaatgatagcaggaaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
26148154 |
cagaccagaagatttgttggcaaattcctatcacagccttcgtaacagccaccataacagcccctgggactttgctttcgcttttaatgatagcaggaaa |
26148055 |
T |
 |
| Q |
200 |
gtggcagcagtacggaggcatc |
221 |
Q |
| |
|
|||||||||| |||||| |||| |
|
|
| T |
26148054 |
gtggcagcaggacggagacatc |
26148033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 49 - 221
Target Start/End: Complemental strand, 25454683 - 25454512
Alignment:
| Q |
49 |
ttgtaaagctttgaaatcctttgtgaatacctgcagtctttgtacacgttccagaccagaagatttgttggcaaattcctatcatagcctccgtaacagc |
148 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||| |||||||||| |||| ||||||||||| ||| |||||||||||||||| ||||||| ||||||| |
|
|
| T |
25454683 |
ttgtagagctttgaaatcctt-gtgaatacctgccatctttgtaca-gttcaagaccagaagacttgatggcaaattcctatcacagcctccataacagc |
25454586 |
T |
 |
| Q |
149 |
caccataacggcccctaggacttttctttcgcttt-taatgatagcaggaaagtggcagcagtacggaggcatc |
221 |
Q |
| |
|
|||||||||||||||||||||| | || ||||| || ||||||||||||| ||||| |||||| |||||||| |
|
|
| T |
25454585 |
aaccataacggcccctaggacttcaccttggctttatagtgatagcaggaaaatggcaacagtacagaggcatc |
25454512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 25515273 - 25515221
Alignment:
| Q |
1 |
caatagcagtacaagaaacaataattgtaaatcaaaccagctaactacttgta |
53 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25515273 |
caatagcaatacaagaaacaataattgtaaatcaaaccagctaactacttgta |
25515221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 26063588 - 26063550
Alignment:
| Q |
1 |
caatagcagtacaagaaacaataattgtaaatcaaacca |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26063588 |
caatagcagtacaagaaacaataattgtaaatcaaacca |
26063550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 26083557 - 26083519
Alignment:
| Q |
1 |
caatagcagtacaagaaacaataattgtaaatcaaacca |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26083557 |
caatagcagtacaagaaacaataattgtaaatcaaacca |
26083519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University