View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3271_low_33 (Length: 239)
Name: NF3271_low_33
Description: NF3271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3271_low_33 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 1762657 - 1762868
Alignment:
| Q |
1 |
attggcaagatcgtgttcgtgctgaggtgcttaaaatttgtggaaatgatggtattatagatgcaaatcaactgaaaagcatgaaaacggtatgttctta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1762657 |
attggcaagatcgtgttcgtgctgaggtgcttaaaatttgtggaaaagatggtattgtagatgcaaatcaactgaaaagcatgaaaacggtatgttttta |
1762756 |
T |
 |
| Q |
101 |
cacaatctatgtactaaagtctcatgttccaatacattatgttttagctagagccgtcaaatgggtcggtcggtctcgttttggtctggtggatccagtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1762757 |
cacaatctatgtactaaagtctcatgttccaatacattatgttttagctagagccatcaaatgggtcggtcggtctcgttttggtctggtggatccagtt |
1762856 |
T |
 |
| Q |
201 |
acataaatgact |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
1762857 |
acataaatgact |
1762868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0147 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 9982 - 10070
Alignment:
| Q |
1 |
attggcaagatcgtgttcgtgctgaggtgcttaaaatttgtggaaatgatggtattatagatgcaaatcaactgaaaagcatgaaaacggta |
92 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || ||||||||||||| || | ||||||||||| ||| | |||||||||||||||| |
|
|
| T |
9982 |
attggcaagatcgtgttcgtgcggaggtgcttgaagtttgtggaaatga---taatctagatgcaaatatacttagaagcatgaaaacggta |
10070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University