View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3272-Insertion-5 (Length: 149)
Name: NF3272-Insertion-5
Description: NF3272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3272-Insertion-5 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 7e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 7e-75
Query Start/End: Original strand, 8 - 149
Target Start/End: Original strand, 7416082 - 7416223
Alignment:
| Q |
8 |
caagcaaaactggaattgcgttaaacagttaatctctaaattatggtttggatttttgttttagaaatatgacttttcaacttcccatcatttccacgaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7416082 |
caagcaaaactggaattgcgttaaacagttaatctctaaattatggtttggatttttgttttagaaatatgacttttcaacttcccatcatttccacgaa |
7416181 |
T |
|
| Q |
108 |
gatgcaagcatcaattggaccacccacccatgcactaaggat |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7416182 |
gatgcaagcatcaattggaccacccacccatgcactaaggat |
7416223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University