View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3272_low_12 (Length: 237)
Name: NF3272_low_12
Description: NF3272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3272_low_12 |
 |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0088 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 41 - 200
Target Start/End: Original strand, 47262 - 47421
Alignment:
| Q |
41 |
gaaagaacaatggatttgttaaaatctggtcaagagagtgtgatagatgcatcacttgaatttcttcgagtaaaagcaaagttaacggtctgttatcttc |
140 |
Q |
| |
|
|||| ||||| ||| |||||||||||||||||||||||||||||| | ||||||||||||| ||||| ||||||||||||| | |||||||||||||||| |
|
|
| T |
47262 |
gaaaaaacaacggaattgttaaaatctggtcaagagagtgtgataaaggcatcacttgaatatcttcaagtaaaagcaaagattacggtctgttatcttc |
47361 |
T |
 |
| Q |
141 |
tctatctaatgaatcatcgacatatttataacaataaagggtctcaaaatgaatcctatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47362 |
tctatctaatgaatcatcgacatatttataacgataaagggtctcaaaatgaatcctatc |
47421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University