View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3272_low_14 (Length: 216)
Name: NF3272_low_14
Description: NF3272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3272_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 119 - 184
Target Start/End: Original strand, 30059552 - 30059617
Alignment:
| Q |
119 |
aggtgctatcatttggggtgaggttctacactggtcacttatttctgtgccagcttcacaggttct |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30059552 |
aggtgctatcatttggggtgaggttctacactggtcacttatttctgtgccagcttcacaggttct |
30059617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 30059434 - 30059494
Alignment:
| Q |
1 |
tttgcagtgttattgatagagaaacgagtgatgtttcaataggtgtttggttcaagttatc |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30059434 |
tttgcagtgttattgatagagaaacgagtgatgtttcaataggtgtttggttcaagttatc |
30059494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University