View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3273_high_34 (Length: 316)
Name: NF3273_high_34
Description: NF3273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3273_high_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 44 - 299
Target Start/End: Complemental strand, 6267330 - 6267077
Alignment:
| Q |
44 |
aaatccttttatcggtgaaccataaaaaatacagttaaatttaattgatggtataaatttattataaataaaaatgagactgattaatctattccaaaat |
143 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
6267330 |
aaatccttttattggtgaaccataaaaaatacagttaaatttaattgatggtataaatttattataaataaaaatgagactgattaatctgttcc-aaat |
6267232 |
T |
|
| Q |
144 |
tctgcaactcaccaaaattctgcaaaagatgcttgctgcaaatnnnnnnnttgtgacagattaatctattcccccatatctctatagttgaatgaaggaa |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6267231 |
tctgcaactcaccaaaattctgcaaaagatgcttgctgcaaataaaaaaattgtgacagattaatctattcccccatatctctatagttgaatgaaggaa |
6267132 |
T |
|
| Q |
244 |
atggtactcatgatgnnnnnnnnnnnaccaatggtactcgtgatgttgattagtgt |
299 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6267131 |
atggtactcatgatg-ttttttttttaccaatggtactcgtgatgttgattagtgt |
6267077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University