View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3273_high_36 (Length: 315)
Name: NF3273_high_36
Description: NF3273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3273_high_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 5e-99; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 34675050 - 34675244
Alignment:
| Q |
1 |
aaatataaaggatccctaacttcaccctatggtccagcatttttgatatacttgttatatgccccaaaaatgtgaagtgttgtagtgagttggatacacg |
100 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675050 |
aaatataaatgatccctaacttccccctatggtccagcatttttgatatacttgttatatgccccaaaaatgtgaagtgttgtagtgagttggatacacg |
34675149 |
T |
 |
| Q |
101 |
ggaacaatggagtcaagaatcagagtgctttcagctctcataactttatgatggtgcacccatcaatcaatttttagtaattttaacaattgtaa |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34675150 |
ggaacaatggagtcaagaatcagagtgctttcagctctcataactttatgatggtgcacccatcaatcaatttttagtaattttaacatttgtaa |
34675244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 195 - 300
Target Start/End: Original strand, 34675526 - 34675631
Alignment:
| Q |
195 |
agccaattggttaccatattattttgctatggttagagagtgtacgactgaactgaaatttcgataaaataaataaatgtaatcaaatcattatgggttt |
294 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675526 |
agccaattggttaccatattattttcctatggttagagagtgtacgactgaactgaaatttcgataaaataaataaatgtaatcaaatcattatgggttt |
34675625 |
T |
 |
| Q |
295 |
gtaagt |
300 |
Q |
| |
|
|||||| |
|
|
| T |
34675626 |
gtaagt |
34675631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University