View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3273_high_41 (Length: 301)
Name: NF3273_high_41
Description: NF3273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3273_high_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 288
Target Start/End: Complemental strand, 40214253 - 40213966
Alignment:
| Q |
1 |
taaaaggataaggtcatttttacaagaagaagctaagacagtacaccatggccaccgaattcaagcaatggagtcttactcaatgcgggtccggttcaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40214253 |
taaaaggataaggtcatttttacaagaagaagctaagacagtacaccatggccaccgaattcaagcaatggagtcttactcaatgcgggtccggttcaac |
40214154 |
T |
 |
| Q |
101 |
attaatttgttccctgcatgcatggcagaaataaataatattcatacaaataatataataaagggtcagtgcaggagaattagcataaatgaatattgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40214153 |
attaatttgttccctgcatgcatggcagaaataaataatattcatagaaataatataataaaggttcagtgcaggagaattagcataaatgaatattgat |
40214054 |
T |
 |
| Q |
201 |
aaatcatttttgcttgtgaaaaaataaaacatccaatccaacactaatttaatatctagaactattactttagaaagcatatatatct |
288 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40214053 |
aaatcgtttttgcttgtgaaaaaataaaacatccaatccaacactaatttaatatctagaactattactttagaaagcatatatatct |
40213966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University