View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3273_high_65 (Length: 248)

Name: NF3273_high_65
Description: NF3273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3273_high_65
NF3273_high_65
[»] chr8 (2 HSPs)
chr8 (156-239)||(39346635-39346718)
chr8 (5-36)||(39346471-39346502)


Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 156 - 239
Target Start/End: Original strand, 39346635 - 39346718
Alignment:
156 tgatagttaatgttgtttattgtgatattaagaatgttttattgtgatgactatgatgagtattgcctccatagtaggaatatt 239  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39346635 tgatagttaatgtcgtttattgtgatattaagaatgttttattgtgatgactatgatgagtattgcctccatagtaggaatatt 39346718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 36
Target Start/End: Original strand, 39346471 - 39346502
Alignment:
5 attttgtagttttcttcatcattgtcgtcttc 36  Q
    ||||||||||||||||||||||||||||||||    
39346471 attttgtagttttcttcatcattgtcgtcttc 39346502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University