View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3273_high_79 (Length: 227)
Name: NF3273_high_79
Description: NF3273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3273_high_79 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 34675023 - 34674801
Alignment:
| Q |
1 |
acatcacatcttgatccgaaattttaagataatagatttatggacatttcacttgtaaattgttcaacctctacttttttaagaaatatgtgaattctta |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675023 |
acatcacatcttgatccaaaattttaagataatagatttatggacatttcacttgtaaattgttcaacctctacttttttaagaaatatgtgaattctta |
34674924 |
T |
 |
| Q |
101 |
ctcacctcacacttgccacaacaatctatgctctcaagtacgagtgatttccattcactatactccccttcaagtgtaagctttttcatccacacacact |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34674923 |
ctcacctcacacttgccacaacaatctccactctcaagtacgagtgatttccattcactatactccccttcaagtgtaagctttttcatccacacacact |
34674824 |
T |
 |
| Q |
201 |
tacttgcactgcctttgcttctc |
223 |
Q |
| |
|
||||||||||||| ||| ||||| |
|
|
| T |
34674823 |
tacttgcactgccattggttctc |
34674801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University