View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3273_low_66 (Length: 250)
Name: NF3273_low_66
Description: NF3273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3273_low_66 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 8 - 250
Target Start/End: Original strand, 40415452 - 40415694
Alignment:
| Q |
8 |
ccaagaatatacttagggaaatgaatgtgattgatcgtaacatgtgtgtcatagtcgtctcggtgttagacattgacaacaaatttaacctgaaatgtca |
107 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40415452 |
ccaataatatacttagggaaatgaatgtgattgatcgtaacatgtgtgtcacagtcgtctcggtgttagacattgacaacaaatttaacctgaaatgtca |
40415551 |
T |
 |
| Q |
108 |
gtgctacttggatataaactgttgccccacgtaccatagtgagtatggagtcatcaattttggaggcacgctgcctccaaatagagctgtttcttgtgcc |
207 |
Q |
| |
|
||| ||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40415552 |
gtgttacttgggtataaactgttgccccacgtaccttagtgagtatggagtcatcaattttggaggcacgctgcctccaaatagggctgtttcttgtgcc |
40415651 |
T |
 |
| Q |
208 |
atcttcaacagaacgtgtctcaaaatttctcctaaatacattc |
250 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40415652 |
atcttcaacagaacgtgtctcacaatttctcctaaatacattc |
40415694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University