View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3273_low_72 (Length: 248)
Name: NF3273_low_72
Description: NF3273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3273_low_72 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 156 - 239
Target Start/End: Original strand, 39346635 - 39346718
Alignment:
| Q |
156 |
tgatagttaatgttgtttattgtgatattaagaatgttttattgtgatgactatgatgagtattgcctccatagtaggaatatt |
239 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39346635 |
tgatagttaatgtcgtttattgtgatattaagaatgttttattgtgatgactatgatgagtattgcctccatagtaggaatatt |
39346718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 36
Target Start/End: Original strand, 39346471 - 39346502
Alignment:
| Q |
5 |
attttgtagttttcttcatcattgtcgtcttc |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39346471 |
attttgtagttttcttcatcattgtcgtcttc |
39346502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University