View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3273_low_75 (Length: 242)
Name: NF3273_low_75
Description: NF3273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3273_low_75 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 18 - 232
Target Start/End: Original strand, 35206822 - 35207042
Alignment:
| Q |
18 |
ccattatgaagggcctaagttcctataaaaatgccattgttaaagctcatcttggagtnnnnnnnnnnnn------cctctcacaaaattgccattttga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35206822 |
ccattatgaagggcctaagttcctataaaaatgccattgttaaagctcatcttggagtaaaaaaaaaaaaaaaaaacctctcacaaaattgccattttga |
35206921 |
T |
|
| Q |
112 |
tcttgcattatcccaccacaagtccaggaaccagtaagagcataatgagcaccatcaacattcaatttgaggacccatgtccgagtgtcaagaaaacacg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35206922 |
tcttgcattatcccaccacaagtccaggaaccagtaagagcataatgagcaccatccacattcaatttgaggacccatgtccgagtgtcaagaaaacacg |
35207021 |
T |
|
| Q |
212 |
agtgagtttcggtctctccac |
232 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
35207022 |
agtgagtttcggtctctccac |
35207042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University