View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3273_low_78 (Length: 240)

Name: NF3273_low_78
Description: NF3273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3273_low_78
NF3273_low_78
[»] chr4 (1 HSPs)
chr4 (175-240)||(12620566-12620631)


Alignment Details
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 175 - 240
Target Start/End: Original strand, 12620566 - 12620631
Alignment:
175 gcaatgttaaatgctgctagatctttaaaacccatacctccattgttcttatgcatcgataatttt 240  Q
    |||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
12620566 gcaacgttaaatgctgctagatctttaaaacccatacctctattgttcttatgcatcgataatttt 12620631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University