View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3273_low_84 (Length: 237)
Name: NF3273_low_84
Description: NF3273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3273_low_84 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 8e-42; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 132 - 222
Target Start/End: Original strand, 31131961 - 31132051
Alignment:
| Q |
132 |
ccttggaatcggtggatcttttgtcgcgatttttaagttctggtcattcggacgaatcttttgtagttgatattgtgataagctttattct |
222 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31131961 |
ccttggaatcggtggatattttgtcgcgatttttaagttctggtcattcggacgaatcttttgtagttgatattgtgataagctttattct |
31132051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 31131830 - 31131916
Alignment:
| Q |
1 |
atttttatggaaagtgaaaaaattcctaaacattggaaccaagcgacggttgaaagaagctgtcgctgaagtaagggggctcgccac |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31131830 |
atttttatggaaagtgaaaaaattcctaaacattggacccgagcgacggttgaaagaagctgtcgctgaagtaagggggctcgccac |
31131916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 134 - 222
Target Start/End: Original strand, 31077937 - 31078025
Alignment:
| Q |
134 |
ttggaatcggtggatcttttgtcgcgatttttaagttctggtcattcggacgaatcttttgtagttgatattgtgataagctttattct |
222 |
Q |
| |
|
|||||||| || |||||||| ||||| ||||||||||| ||||||||||| ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
31077937 |
ttggaatcagttgatcttttatcgcggtttttaagttcgggtcattcggatgaatcatttgtagttgatattgtaataagctttattct |
31078025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 158 - 222
Target Start/End: Original strand, 31127279 - 31127343
Alignment:
| Q |
158 |
cgatttttaagttctggtcattcggacgaatcttttgtagttgatattgtgataagctttattct |
222 |
Q |
| |
|
|||||||||||||| |||||||| || ||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
31127279 |
cgatttttaagttcaggtcattcagatgaatcttttgttgttgatattgtaataagctttattct |
31127343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 6 - 75
Target Start/End: Original strand, 31077809 - 31077878
Alignment:
| Q |
6 |
tatggaaagtgaaaaaattcctaaacattggaaccaagcgacggttgaaagaagctgtcgctgaagtaag |
75 |
Q |
| |
|
||||||||||||| ||| | ||||||| || | | ||||||| ||||||||||| |||||||||||||| |
|
|
| T |
31077809 |
tatggaaagtgaagaaaatattaaacatagggatcgagcgacgattgaaagaagccgtcgctgaagtaag |
31077878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University