View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3273_low_90 (Length: 215)
Name: NF3273_low_90
Description: NF3273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3273_low_90 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 198
Target Start/End: Complemental strand, 29987850 - 29987671
Alignment:
| Q |
19 |
cataccgcttgatacgttgatagctacatctagtttcttaacatcttgaaggattttccactataattaacattattacacaaccttgagagtatacttc |
118 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29987850 |
catagcgcttgatacgttgatagctacgtctagtttcttaacatcttgaaggattttccactataattaacattattacacaaccttgagagtatacttc |
29987751 |
T |
 |
| Q |
119 |
aaatcatttgagaaatagtacatgttgatttatcctagaatcacttggttgaaaatctgttctttaatcttggcgaccta |
198 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
29987750 |
aaatcatttgagaaatagtacatgtcgatttatcctagaatcactaggttgaaaatatgttctttaatcttggcgaccta |
29987671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 176
Target Start/End: Complemental strand, 27058246 - 27058218
Alignment:
| Q |
148 |
ttatcctagaatcacttggttgaaaatct |
176 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27058246 |
ttatcctagaatcacttggttgaaaatct |
27058218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University