View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3274_high_10 (Length: 246)
Name: NF3274_high_10
Description: NF3274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3274_high_10 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 135 - 246
Target Start/End: Complemental strand, 15639166 - 15639055
Alignment:
| Q |
135 |
tatactttcttggtgtagtttgttatgaatatgcataaattatcctcaaacagtttactctcaaattcatttaattatgatttctatgaatatttctttg |
234 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15639166 |
tatactttcttggtgtagtttattatgaatatgcataaattatcctcaaaccgtttactctcaaattcattgaattatgatttctatgaatatttctttg |
15639067 |
T |
 |
| Q |
235 |
tttaactcccaa |
246 |
Q |
| |
|
|||||||||||| |
|
|
| T |
15639066 |
tttaactcccaa |
15639055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 24 - 103
Target Start/End: Original strand, 8440120 - 8440199
Alignment:
| Q |
24 |
acaaaatttacaaggcaacaacctcaaccaaacaagagcaatctttatttggatcaaaacatacggtatacatgccatcc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8440120 |
acaaaatttacaaggcaacaacctcaaccaaacaagagcaatctttatttggatcaaaacatacggtatatatgccatcc |
8440199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 17 - 66
Target Start/End: Complemental strand, 19783458 - 19783409
Alignment:
| Q |
17 |
aatatttacaaaatttacaaggcaacaacctcaaccaaacaagagcaatc |
66 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
19783458 |
aatatttacaaaatttacaaggcaacagcctgaaccaaacaagagcaatc |
19783409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University