View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3274_low_17 (Length: 215)
Name: NF3274_low_17
Description: NF3274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3274_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 227217 - 227118
Alignment:
| Q |
1 |
tagctttaggtcttcccatgatttgattgtatttcaatttatgatatattgtcaagtagaactagtagttttagactcaaggttaacaaatctttgtagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
227217 |
tagctttaggtcttcccatgatttgatttgatttcaattgatgatatattgtcaagtagaactcgtagttttagactcaaggttaacaaatctttgtagt |
227118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University