View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3275_high_3 (Length: 331)
Name: NF3275_high_3
Description: NF3275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3275_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 9e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 60 - 321
Target Start/End: Complemental strand, 2912977 - 2912715
Alignment:
| Q |
60 |
tagagaatttagggttcaaactccggtcactgcggattgatggaagctcgtgggacattagaagataggttctataagcaaaatcagaagattcggatag |
159 |
Q |
| |
|
|||||||||||| |||||||||||||| ||| ||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2912977 |
tagagaatttagcgttcaaactccggt----gcgaattgatgaaagcttgtgggacattagaagataggttctataagcaaaatcagaagattcggatag |
2912882 |
T |
 |
| Q |
160 |
gttgagcaactcaaggctattaaagcaatttccttgaataattaat-----aactacccagaaactactcgtgttagtttcggnnnnnnnatctctaata |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
2912881 |
gttgagcaactcaaggctattaaagcaatttccttgaataattaattaataaactacccagaaactactcgtgttagtttcggtttttttacctctaata |
2912782 |
T |
 |
| Q |
255 |
cttcttaaaaattggttttacaggttcttttactttgtcaaatcgaagaaaatattcactacctttg |
321 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2912781 |
ctttttaaaaattggttttacaggttcttttactttgtcaaatcgaagaaaatattgactacctttg |
2912715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University