View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3275_low_8 (Length: 243)
Name: NF3275_low_8
Description: NF3275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3275_low_8 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 122 - 243
Target Start/End: Original strand, 31008876 - 31008998
Alignment:
| Q |
122 |
tattttttaatctattctataatgaaaaattactcatttctaattttaagacaatgactaatcttatttcttataatagccc-ttgttgtttttgagggg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
31008876 |
tattttttaatctattctataatgaaaaattactcatttctaattttaagacaatgattaatcttattgcttataatagccctttgttgtttttgagggg |
31008975 |
T |
 |
| Q |
221 |
aatataataaccctttattattt |
243 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
31008976 |
aatataataaccctttattattt |
31008998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University