View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3276_high_23 (Length: 239)
Name: NF3276_high_23
Description: NF3276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3276_high_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 42100181 - 42100401
Alignment:
| Q |
1 |
tactaaacgcgtgcattactatgtgattacaagtgttatgaatgacatttacatatgatcatccaattgcccaaagaaaaacaacaaaattgaatatcat |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42100181 |
tactaaatgcgtgcattactatgtgattacaagtgttatgaatgacatttacatatgatcatccaattgcccaaagaaaaacaacaaaattgaatatcat |
42100280 |
T |
|
| Q |
101 |
aggttgttgcggttgtgatacggggttacacttcggtgacattgagacttaattagcaacacatttggaggtaacacttcgacgactttgagtttgatga |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42100281 |
aggttgttgcggctgtgatacggggttacacttcggtgacattgagacttaattagcaatatatttggaggtaacacttcgacgactttgaatttgatga |
42100380 |
T |
|
| Q |
201 |
ctttgtctctatctcgcttct |
221 |
Q |
| |
|
|||||| ||||||| |||||| |
|
|
| T |
42100381 |
ctttgtttctatcttgcttct |
42100401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 24 - 87
Target Start/End: Complemental strand, 41830657 - 41830594
Alignment:
| Q |
24 |
tgattacaagtgttatgaatgacatttacatatgatcatccaattgcccaaagaaaaacaacaa |
87 |
Q |
| |
|
|||||||||| ||||||||| ||| ||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
41830657 |
tgattacaaggcttatgaatgtcatatacatatgatcatccaagtgctcaaagaaaaacaacaa |
41830594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 36 - 66
Target Start/End: Complemental strand, 3051936 - 3051906
Alignment:
| Q |
36 |
ttatgaatgacatttacatatgatcatccaa |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3051936 |
ttatgaatgacatttacatatgatcatccaa |
3051906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University